Skip to content

Ekspresja ludzkiego herpeswirusa 8 w pierwotnym nadciśnieniu płucnym czesc 4

1 miesiąc ago

490 words

Pokrótce, po zatopieniu bloków zatopionych w parafinie w 5-.m przekroje i zamontowano na szkiełkach, próbki poddano deparafinizacji i ponownie uwodniono. Odzyskiwanie antygenu w wysokiej temperaturze polegało na gotowaniu szkiełek w buforze cytrynianowym (10 mM na litr, pH 6,0) przez 20 minut, a następnie inkubacji z kompleksem awidyna-biotyna-peroksydaza (zestaw Vectastain Elite ABC, Vector Laboratories) zgodnie z instrukcjami producenta . W celu wykrycia LANA-1 próbki inkubowano z pierwszorzędowym przeciwciałem (rozcieńczenie, 1: 1500) w temperaturze pokojowej przez jedną godzinę. Próbki następnie barwiono 3,3 -diaminobenzydyną jako chromogenem i barwiono kontrastowo hematoksyliną Mayera. Do kontroli negatywnej zastosowano normalną surowicę blokującą bez pierwotnego przeciwciała. W celu porównania mięsaka Kaposiego i zmian spastycznych wybrane skrawki wybarwiono immunologicznie przeciwciałem przeciwko czynnikowi wzrostu śródbłonka naczyniowego (VEGF) (rozcieńczenie 1: 300; Dako). Przeprowadzono również test immunofluorescencyjny dla antygenu związanego z czynnikiem VIII (rozcieńczenie 1: 1000; Dako), w którym próbki inkubowano z przeciwciałem drugorzędowym przeciw koziołkowatym (rozcieńczenie 1: 200) skoniugowanym z fluoresceiną (Molecular Probes).
Wirusowe analizy cyklin HHV-8
W celu ekstrakcji DNA wykorzystano utrwaloną formaliną tkankę zatopioną w parafinie. Z każdego bloku parafiny wycięto pięć mikrometrów i umieszczono w 0,5 ml probówkach MicroAmp (Perkin-Elmer Applied Biosystems). Skrawki tkanki dwukrotnie odparowano w ksylenie przez pięć minut każda, a następnie dwuetapową rehydratację w 100% etanolu. Osuszoną powietrzem peletkę ponownie zawieszono w buforze z proteinazą K, inkubowano przez 18 godzin w 37 ° C i 3 godziny w 55 ° C, a następnie inaktywowano termicznie przez 10 minut w 98 ° C.
Primery PCR zsyntetyzowano w celu amplifikacji wirusowej cykliny HHV-8 kodowanej przez ORF72. Zestaw starterów KS1 i KS2 (KS1, 5 CGCCTGTAGAACGGAAACAT; KS2, 5 TTGCCCGCCTCTATTATCAG) amplifikuje 138-bp fragment HHV-8. Warunki PCR zostały wcześniej opisane.24
DNA z każdego produktu PCR oznaczono ilościowo za pomocą fotopektrometrii w ultrafiolecie, a następnie rozcieńczono do stężenia 20 ng na mikrolitr wody. Startery specyficzne dla ORF72 rozcieńczono do stężenia 10 .M w wodzie. Próbki zsekwencjonowano w ośrodku podstawowej biologii molekularnej Diabetes and Endocrinology Research Center (Centrum im. Barbary Davis, University of Colorado Health Sciences Centre). Zastosowaliśmy program Podstawowego Lokalnego Wyrównania Wyszukiwania 2 (BLAST2) Narodowego Centrum Informacji Biotechnologicznej, który wyrównuje dwie sekwencje, aby określić stopień homologii między dwiema sekwencjami.25
Analiza BMPR2 dla mutacji
DNA od 16 pacjentów z pierwotnym nadciśnieniem płucnym poddano badaniom przesiewowym pod kątem co najmniej siedmiu spośród najczęściej zgłaszanych mutacji w genie BMPR2. Mutacje K230fs, I860fs i R899X zostały zgłoszone przez dwie lub więcej niezależnych grup.1,26-28 Szczegóły analizy znajdują się w Dodatkowym dodatku 2, dostępnym wraz z pełnym tekstem tego artykułu na stronie http: //www.nejm .org.
Wyniki
Ekranizacja
W badaniu przesiewowym, 4 z 15 mikroskopijnych zmian splotu plexiform od pacjentów z nadciśnieniem płucnym było pozytywnych dla ORF26 metodą PCR.
Badania immunohistochemiczne
Rysunek 1
[więcej w: warszawa stomatologia, zdrowie co to jest, neurolog od kręgosłupa ]
[więcej w: toxo igg cena, dentysta z wieży, gumtree gdańsk ]

0 thoughts on “Ekspresja ludzkiego herpeswirusa 8 w pierwotnym nadciśnieniu płucnym czesc 4”